Regular expressions (grep) to match a repetitive two-letter pattern

Question

I want to use a regular expression that would match the pattern 'ATATAT' (of any length) and/or 'GCCGCCGCC' (again of any length) in a text file. I have only four options and one of them should work, but I have tried all of them on a text file containing those patterns several times. But any of the codes below either don't return anything or end up in an error: "grep: Invalid back reference". Maybe I shouldn't be using grep at all?

• [ATGC]{2,}
• ([ATGC]{2,})\1+
• ([ATGC]{2,}){2,}
• ([ATGC])\1+

Principally, the code I am using is the following:

grep 'one_of_the_patterns_above' DNA_sequence_file.fasta

And the file looks something like this:

>sampled sequence 1 consisting of 500 bases.
GCAAAGTAGCCGAGGTCAGGGCATGTCAATGATAGCGCGAAAAGGTCACCACGAGAAGCG
GCACTCGGCCACGGATTGGTGGCACTTCATATGGAAACGCGACGACCGATAAAAACACAA
CGAAACCCAATTGGAATGAGATTTTCCTGAAACCGCAGCGAACCCAACCAAGCGGGAATA
AAGTCGGGAAGTCTAAACGAGATTAGCAGAATCCACCTCAGAATGACTGATGCCATGTAG
GCGCAGCAATAGATTACCGAAAGAGAAACACAGCAACGGATACATACAACTCAAGGGAAG
AGCACCTTTCGCTGAGAGGAGACGCCTTACAAACTATCCAGGGGTTTGAACAAGACAGGT
CGAAAAGCGGCCCTCTTCACAACCAGGTCAAGCGCGACTCGAGACAAGTATTCCCAAAGT
CCAAAAAAGAATCCTACAGAATCCCATCAAAGCATTTGTAGAAAGACATGGCCTACCAGC
TGCGCAAAGGACACATTACC

Answer 1

It looks like you want to match "AT" repeated at least twice, or, in your other example, "GCC" repeated at least twice. Those would be, respectively:

(AT){2,}
(GCC){2,}

Note that you will have to use grep -E for these patterns to match. (There isn't a single, consistent syntax for regular expressions that works identically across tools, so you may have to adapt depending on which you end up using.)

Answer 2

All of the patterns are bad, they match any ATGC in any order. The correct regexp is:

^((AT)*|(GCC)*)$

This is doing what you wrote.