FOK

Also found in: Financial, Acronyms, Encyclopedia.

fill or kill

In stock trading, an instruction to fill an order in its entirety at once and, if that cannot be done, to cancel it. No, we have to cancel this order now—it was fill or kill. A: "Is this fill or kill?" B: "Yeah. Will you guys have enough time to handle it ASAP?" I'm not worried about this order being fill or kill—I can start working on it right now.

FOK

An acronym for "fill or kill," an instruction in stock trading to fill an order in its entirety at once and, if that that cannot be done, to cancel it. No, we have to cancel this order now—it was FOK. A: "Is this FOK?" B: "Yeah. Will you guys have enough time to handle it ASAP?" I'm not worried about this order being FOK—I can start working on it right now.

fill or kill

and FOK

phr. a broker’s notation advising the stock exchange to fill a stock order or kill it. (The abbreviation is an initialism. Securities markets.) Get rid of this order. It was fill or kill, and it should have been killed yesterday.

FOK

verb

See fill or kill

See also:

References in periodicals archive ?

The primers used for Fok I are forward 5' AGCTGGCCCTGGCACTGACTCTGCTCT'3 and reverse 5'ATGGAAACACCTTGCTTCTTCTCCCTC'3 and for Apa I are forward 5' CAGAGCATGGACAGGGAGCAA'3 and reverse 5'GCAACTCCTCATGGCTGAGGTCCTC' 3.

Serum vitamin D levels and gene polymorphisms (Fok1 and Apa1) in children with type I diabetes and healthy controls

Managing Director Mark Flanighan said: "I'm honestly delighted with the way Cristian has blended into FOK Marketing.

From Italy to Teesside

"Organising such a large-scale event [like the Asian Games] always arouses public interest and participation in sports activities, bringing about substantial benefits to health and overall quality of living," Fok added.

Hong Kong makes all the right moves in pursuit of 2023 Games

"We chose brass as the material for the fins because it has a density about 7,000 times that of air, a large ratio that is needed to achieve the strong anisotropy required for a flat dispersion of the sound waves," Fok added.

World's first acoustic hyperlens could improve sonar devices

Timothy Fok, Hong Kong's Sports Federation and Olympic Committee president, who has hinted he could be one of the 120 torchbearers for the Hong Kong leg, said the protests so far ''have sacrificed the Olympic spirit.''

H.K. rights advocates mull demonstration during Olympic torch relay

Oxford University student Tsz Fok, aged 22, who lived with his mother in Kings Heath, was described as "probably the brightest A-level candidate in the country" by exams body the Qualifications and Curriculum Authority in 2003.

Star student killed in bin lorry crash

It is thought a bid could be tabled as early as today to Canning Fok, managing director of Hutchison Whampoa, and Ravi Ruia, vice chairman of Essar.

Vodafone mulls bid

Wie de fok het die fokken plek toegemaak?" Die vraag hang in die lug.

O, Griet! Skryf 'n parodie: Twee sprokies op die maat van 'n Opdrag

Alternative: Czech Suite--Pesek, (Virgin), Prague Chamber Orchestra, Vlcek; Vlach (Supraphon), Polonaise in E Flat major--Neumann, Czech Philharmonic (Orfeo), Polonaises and Waltzes--Belohlavek, FOK (Supraphon).

Antonin Dvorak

Kwon E, Zhang H, Wang Z, Jhangri GS, Lu X, Fok N, et al.

Arsenic on children's hands after playing in playgrounds

Fong, assistant to Timothy Fok, SFOC prexy and Intl.

Rivals wrangling over Olympic tribute show

Nineteen year Tsz Fok from King's Heath, Birmingham spent his gap-year before University with Wolverhampton based Turner Powertrain Systems.

Industry reward

Hutchison Whampoa Ltd CEO Canning Fok said the company's third-generation mobile operation could break even earlier than expected.

Hutchison Whampoa Expects Early Profits From 3G

CITE

Site: Follow: Share:

Open / Close