Google Genomics — Google Cloud Platform

archived 19 Jan 2015 02:15:58 UTC
Google Genomics
Adobe Flash Player or an HTML5 supported browser is required for video playback.
Get the latest Flash Player
Learn more about upgrading to an HTML5 browser
  • Explore genetic variation interactively. Compare entire cohorts in seconds with SQL-like queries. Compute transition/transversion ratios, genome-wide association, allelic frequency and more.
  • Process big genomic data easily. Run batch analyses like principal component analysis and Hardy-Weinberg equilibrium on as many samples as you like, in minutes or hours, with just a little code.
  • Use Google's infrastructure and big data expertise. Store one genome or a million using Google Genomics and take advantage of the same infrastructure that powers Search, Maps, YouTube, Gmail and Drive.
  • Support emerging global standards. Google Genomics is implementing the API defined by the Global Alliance for Genomics and Health for visualization, analysis and more. Compliant software can access Google Genomics, local servers, or any other implementation.

Try it now

Sign up

  1. If you don't already have one, sign up for a Google Account.
  2. Create a Genomics enabled project via the Google Developers Console.
  3. Once you are redirected to the Credentials page, click Create new client ID.
  4. On the Content screen page, fill out the required information and click Save.
  5. Under Application type, select Installed application.
  6. Under Installed application type select Other.
  7. Click Create Client ID.
  8. Under Client ID for native application, click Download JSON.
  9. Rename the downloaded file to client_secrets.json.
The first time you query the API you will be authenticated using the client secrets file you downloaded. This will save a token which will be used on subsequent API requests.

Install the Genomics tools

The Genomics tools are hosted on GitHub. You can download the Java client JAR file or use curl:
$ curl -O -L https://github.com/googlegenomics/api-client-java/raw/master/genomics-tools-client-java-v1beta2.jar

Search for reads

Submit a search by providing the client a set of read group set IDs, along with a genomic range to query. Google has pre-loaded public read group sets from the 1000 Genomes Project that you can search against.
$ java -jar genomics-tools-client-java-v1beta2.jar searchreads --client_secrets_filename client_secrets.json --reference_name "chr20" --start 68198 --end 69000 --id "CJ_ppJ-WCxDxrtDr5fGIhBA"

result: {"alignedQuality":[33,33,37,37,33,37,37,33,33,33,37,37,37,37,37,37,37,37,37,37,37,37,37,37,37,37,40,40,40,40,40,40,40,37,37,37,33,37,37,40,40,40,40,40,40,40,40,40,40,37,37,40,40,40,40,40,37,40,40,37,37,40,40,40,40,40,40,40,40,37,37,37,40,40,37,37,40,40,40,40,37,37,37,37,37,37,33,37,33,33,27,15,37,37,37,37,37,33,33,33],"alignedSequence":"CTTACAGTTCTACGGGATAATAGCTTATCTCATAAGGCCTCAGCTTTCTTTAATAATTTCTAGAAGCAGACGTTATTGTGTCATGCACACTAAGTGTTGC","alignment":{"cigar":[{"operation":"ALIGNMENT_MATCH","operationLength":"100"}],"mappingQuality":60,"position":{"position":"68099","referenceName":"chr20","reverseStrand":true}},"duplicateFragment":false,"failedVendorQualityChecks":false,"fragmentLength":-268,"fragmentName":"H7F3RADXX_1:1:1207:2208623:0","id":"ChdDSl9wcEotV0N4RHhydERyNWZHSWhCQRIFY2hyMjAYg5QEKAA","info":{"AS":["1073"],"BC":["none"],"MQ":["60"],"NM":["1"],"RG":["2"],"SM":["484"]},"nextMatePosition":{"position":"67930","referenceName":"chr20","reverseStrand":false},"numberReads":2,"readGroupId":"ChdDSl9wcEotV0N4RHhydERyNWZHSWhCQRAC","readGroupSetId":"CJ_ppJ-WCxDxrtDr5fGIhBA","readNumber":1,"secondaryAlignment":false,"supplementaryAlignment":false}...

What next?

  • View the code samples to see how to call the API programmatically for alignment slicing, genome browsing, and parallel computing.
  • Join the discussion about Google Genomics.
  • Contact us. All questions and comments are welcome!
Except as otherwise noted, the content of this page is licensed under the Creative Commons Attribution 3.0 License, and code samples are licensed under the Apache 2.0 License. For details, see our Site Policies.
Last updated December 12, 2014.
0%
 
10%
 
20%
 
30%
 
40%
 
50%
 
60%
 
70%
 
80%
 
90%
 
100%